A set of vectors and strains for chromosomal integration in fission yeast

Nov 30, 2023

Scientific Reports volume 13, Article number: 9295 (2023) Cite this article

Metrics details

The expression of heterologous genes is an important technique in yeast genetics. In fission yeast, the leu1 and ura4 genes have been used mainly as selectable markers for heterologous expression. To expand the repertoire of selection markers available for heterologous expression of genes, here we developed new host-vector systems employing lys1 and arg3. By employing genome editing with the CRISPR/Cas9 system, we isolated several alleles of lys1 and arg3, each having a critical mutation in the ORF region. In parallel, we developed a set of vectors that complement the amino acid auxotrophy of lys1 and arg3 mutants when integrated into each locus. Using these vectors in combination with the previously developed integration vector pDUAL, we successfully observed the localization of three proteins in a cell simultaneously by fusing them with different fluorescent proteins. Thus, these vectors enable combinatorial expression of heterologous genes, which addresses increasingly diverse experimental challenges.

The study of yeast biology has stimulated the development of sophisticated experimental systems for elucidating the molecular mechanisms underlying a variety of biological phenomena. Recently, to explore these molecular mechanisms more deeply, complicated experimental systems are sometimes required. In many cases, such a complicated experiment necessitates the expression of multiple transgenes in a cell. For this purpose, several vectors, which can be used as episomal plasmids or integrative vectors, and constitutive or inducible promoters have been developed1, 2. Expression systems that can reproduce conditions similar to physiological environments are preferred. In this sense, the use of integrative vectors is one of the leading-edge systems used in yeast biology rather than episomal vectors3.

We have previously developed two types of episomal vectors that can also be used for chromosomal integration by single crossover recombination4, 5. One type of vector is designed to be integrated into either the lys1, arg1, or his3 loci. When these vectors are successfully integrated into the target loci, the transformants become auxotrophic for the corresponding amino acids. The merit of these vectors is that they can be used for strains having no amino acid auxotrophy. Therefore, in many cases, these vectors can be used without preparing a new host strain. However, the fact that the integration of the vectors into the genome results in amino acid auxotrophy is a disadvantage in some cases. On the other hand, the pDUAL series vectors are designed for integration into the leu1 locus4. Although they can be used only for strains having the leu1-32 allele, the transformants become prototrophic for leucine, enabling easy selection of the transformants (Fig. 1). The fact that the pDUAL vectors do not contain a functional copy of the leu1 gene avoids the selection of transformants in which plasmids are randomly integrated into the genome. Although both types of vectors have their own advantages and disadvantages, pDUAL-type vectors seem more useful from the viewpoint of selection and maintenance of proper transformants.

Integration of pDUAL into the genome of the leu1-32 mutant. pDUAL series vectors have a part of the leu1 gene containing restriction enzyme recognition sites within the leu1 ORF region. When single crossover recombination occurs downstream of the mutation point of the leu1-32 allele, the resultant genome is expected to have two copies of leu1, one which lacks the 3’ part and the other being a full-length functional gene. The schematic is not to scale.

In this paper, by taking the strategy of pDUAL-type single crossover recombination into account, we tried to develop new host-vector systems targeting loci other than leu1. Using the recently developed CRISPR/Cas9 system in fission yeast6, we successfully isolated strains with critical frameshift mutations in lys1 or arg37, 8. We also constructed vectors that could complement the amino acid auxotrophy of these mutants upon targeted integration into the chromosome. Together with the previously developed pDUAL vectors, expression of three transgenes in prototroph transformants is now available without using drug-resistant markers.

S. pombe strains used in this study were derived from the wild-type strains JY743 (h– leu1-32 ura4-D18) or AM324 (h+ leu1-32). The genomic DNA of wild-type JY3 (h90 prototroph) was used for PCR amplification of gene fragments for plasmid construction. Complete medium YE (0.5% yeast extract, 2% glucose, 5 µg/ml adenine) and minimal media SD and EMM29 were used for culturing transformants. Leucine, arginine, lysine, histidine, and uracil were used at a final concentration of 50 µg/ml each, when needed. EMM2 was also used for transcriptional induction of ORFs fused with fluorescent proteins under the regulation of the nmt1 promoter10.

Genetic methods to handle fission yeast were previously described9. Transformation of S. pombe cells was also described11. Ura+, Lys+, and Arg+ transformants were selected on SD medium lacking uracil, lysine, and arginine, respectively. When isolating mutant alleles of lys1, arg1, and his1, transformants were grown on SD medium containing leucine and either of lysine, arginine, or histidine, respectively.

Isolation of strains having critical mutations in genes involved in amino acid biosynthesis pathways was carried out using the CRISPR/Cas9 system as reported by Zhang et al.12, with slight modifications. Plasmids pDB4280 (cat. no. 98699) and pDB4282 (cat. no. 98701) for the fission yeast CRISPR/Cas9 system were provided from the Addgene repository. Design of single-guided RNAs (sgRNAs) was done using the web-based tool CRISPR4P13. Among target sites suggested by this program, we selected two sequences for each gene, which are positioned relatively close to the 5’ end of each ORF. Homology arms were shortened to 30 nt compared to the 40 nt indicated by Zhang et al.12. Sequences for annealing with the template vector pDB4282 were shortened to 20 nt, compared to the 23 nt indicated by Zhang et al. Primer sequences used were as follows: his1-sgRNA1 (TTGCCAAAAAACATAACCTGTACCGAAGAACAAGTCCAGGTACCTGAGTCGTTTTAGAGCTAGAAATAGC), his1-sgRNA2 (TTGCCAAAAAACATAACCTGTACCGAAGAAGGTGAGACAATGCGTGCATCGTTTTAGAGCTAGAAATAGC), arg3-sgRNA1 (TTGCCAAAAAACATAACCTGTACCGAAGAATCATGATCTCTCCGGTGACTGTTTTAGAGCTAGAAATAGC), arg3-sgRNA2 (TTGCCAAAAAACATAACCTGTACCGAAGAATCCATTCGTGATCTTAGTCGGTTTTAGAGCTAGAAATAGC), lys1-sgRNA1 (TTGCCAAAAAACATAACCTGTACCGAAGAATTTAGCCAAAGTGTGCGATCGTTTTAGAGCTAGAAATAGC), and lys1-sgRNA2 (TTGCCAAAAAACATAACCTGTACCGAAGAAATCCTCGTTAGTCGCATGACGTTTTAGAGCTAGAAATAGC). Each primer was used in PCR in combination with the ura4-P75 primer (CATCTGGTGTGTACAAAATTG) to amplify the region of pDB4282 containing a part of the ura4 marker, the hammerhead ribozyme sequence, and the sgRNA scaffold sequence12. The PCR reaction was carried out in a 20 µl scale, and successful amplification was confirmed by agarose gel electrophoresis. The PCR product (2.5 µl) was directly used for transformation of the host strain JY743 together with the pDB4280 plasmid digested with NotI and purified by ethanol precipitation. One microgram of salmon sperm DNA was also used for transformation. Transformants were grown on an SD plate containing leucine and either histidine, arginine, or plate to prepare master plates. Amino acid auxotrophy of the transformants was then confirmed by streaking them on the SD plate lacking a corresponding amino acid.

All lys1 and arg3 mutants utilized in this study were deposited at the Yeast Genetic Resource Center (YGRC/NBRP) of Japan, alongside strains obtained from lys1-K24 or arg3-R25 mutants via genetic crosses with ade6 and ura4 mutants. The strains have been assigned accession IDs FY47712-FY47734.

Sequence analysis of the lysine auxotrophic alleles was done as described below. The region around the sgRNA target site was amplified by PCR using the genome of each candidate. Primers used for amplification of the region around the target sites of lys1-sgRNA#1 and lys1-sgRNA#2 were lys1-F-puc119 (CTCTAGAGGATCCCCTTGACACTCTCCGTTAC) and lys1-R-puc119 (TCGAGCTCGGTACCCCACCGATAGGACCTGTAA). The resultant PCR fragments were cloned into the vector pUC119 by the gap-repair cloning technique14. The whole inserts were sequenced using a 3730xl DNA Analyzer (Applied Biosystems).

Sequence analysis was also done for mutant alleles of his1 and arg3 in a similar way. Primers used were as follows: arg3-F-puc119 (CTCTAGAGGATCCCCGCAGTCTGAGAGAGAACTAG) and arg3-R-puc119 (TCGAGCTCGGTACCCGTCTTTAGAAGCCTGTGTC) for arg3; and his1-F-puc119 (CTCTAGAGGATCCCCTGCATAGAGGGTCGTTT) and his1-R-puc119 (TCGAGCTCGGTACCCCGAGTGAATGCTGAGGA) for his1. PCR products were cloned into the E. coli vector pUC119 digested with SmaI.

To construct the vector pCLys1, we replaced the leu1 fragment of pDUAL containing the nmt1 promoter4 with a part of the lys1 gene containing the lys1 promoter and the 5’ part of its ORF. This region was amplified by PCR using the genomic DNA of the wild-type S. pombe strain JY3. The restriction enzyme recognition site for NotI was generated within this region by catenating two PCR fragments containing the NotI site on one side by PCR. Primers used were as follows: KpnI-Plys1-F3 (GGGATAACAGGGTAATATGGTACCGAGCTGTTTGGACATGTTATG) and NotI-lys1-R3 (AACTACATCAGCGGCCGCTCTCAATTCCATTCTTTACGAG); and NotI-lys1-F4 (GGAATTGAGAGCGGCCGCTGATGTAGTTATGGTTTATGC) and EcoRI-lys1-R4 (CGTTGTAAAACGACGGCCAGTGAATTCGTCAGCTCCTTTTGAGACTG). Cloning of the catenated PCR fragment into the vector was done using the In-Fusion HD Kit (TaKaRa Bio).

Construction of the pCArg3 vector was carried out in a similar way. Primers used were as follows: KpnI-Parg3-F1 (GGGATAACAGGGTAATATACTAGTCGGTACCTGAGTTATCAATATAGTAACAC), NotI-arg3-R1 (AACGTTATTGCGGCCGCATCACCTACCCATGCAAC), NotI-arg3-F2 (GTAGGTGATGCGGCCGCAATAACGTTTTACATGATTTG), and EcoRI-arg3-R2 (TGTAAAACGACGGCCAGTGAATTCAGCATTTTTAACAGCAACC).

The full sequences of pCLys1 and pCArg3 are deposited in the DDBJ database with accession numbers LC745737 and LC745738, respectively. These plasmids were also deposited at the Yeast Genetic Resource Center of Japan with accession numbers for FYP5995 (pCLys1) and FYP5996 (pCArg3), so that they are available upon request.

Construction of pCLys1 and pCArg3 vectors containing GFP or mCherry was completed as described below. First, the ORF of GFP or mCherry was cloned into each of pCLys1 and pCArg3. Primers used for amplification of GFP were as follows: NheI-GFP-F (TTATAGTCGCTTTGTTAAAGCTAGCCTCGAGCCCGGGATGAGTAAAGGAGAAGAAC) and BamHI-GFP-R (GCTTATTTAGAAGTGGCGCGCCGGATCCCGGGTTTGTATAGTTCATCCATGCC). pDUAL-GFH14 was used as a template for PCR. A GFP fragment was amplified and then mixed with pCLys1 or pCArg3 digested with NheI and BamHI, and the mixture was introduced into competent cells of the E. coli strain DH5α. mCherry was also cloned into the same vectors in a similar way. Primers used for amplification of mCherry were SmaI-mC-F (TTATAGTCGCTTTGTTAAAGCTAGCCTCGAGATGGTGAGCAAGGG) and SmaI-mC-R (ATTTAGAAGTGGCGCGCCGGATCCCGAGCTCGTCCATGCCGCCG). The amplified mCherry fragment was mixed with the vectors digested with SmaI, followed by introduction into E. coli.

ORFs to be fused with GFP or mCherry were amplified by PCR from our entry clone collection of the fission yeast ORFeome15. Primers used for amplification were Ent-GFP-R (CCTTTACTCATCCCGGGCTCGAGGCTAGCAACTTTGTACAAGAAAGCTGGGTA) for GFP-fusion and Ent-mC-R2 (CGCCCTTGCTCACCATCTCGAGGCTAGCAATGCCAACTTTGTACAAGAAAGCTG) for mCherry fusion, in combination with 221_pREY_F (ACTTATAGTCGCTTTGTTAAAGCTAGCGATATCAAAAAAGCAGGCTCTCATATG) as a partner of the above two primers. Each amplified ORF was cloned into pCLys1 or pCArg3 containing GFP or mCherry via gap-repair techniques. Cloning of an ORF into the pDUAL vector having YFP (pDUAL-YFH1c) was done by Gateway technology.

Fluorescence of CFP, GFP, YFP, and mCherry was observed using the all-in-one fluorescence microscope BZ-X700 (KEYENCE). The objective lens CFI Plan Apo λ 100XH (Nikon) was used. Cells were precultured on a YE or EMM2 plate containing thiamine and then streaked on an EMM2 plate to induce expression of fluorescent protein-fused proteins driven by the nmt1 promoter.

To allow pDUAL-type single crossover chromosomal integration, strains having a point mutation in genes preferably encoding proteins functioning in the amino acid or nucleotide biosynthesis pathway are needed. There are several such auxotrophic mutants in fission yeast. However, the mutation points of most of them have not been identified or are not suitable for integration mediated complementation in view of the position. We therefore employed the CRISPR/Cas9 system to isolate such biosynthesis pathway mutants, according to the cloning-free method recently reported by Zhang et al.12.

In the field of fission yeast genetics, leu1, ade6, and ura4 have been widely used as selection markers16,17,18. The leu1 gene is located on the right arm of chromosome 2, whereas ade6 and ura4 are located on chromosome 3. We selected integration loci from chromosome 1 to enable easy handling in the genetic cross between new markers and the above three loci. As a result, we selected three genes—lys1, arg3, and his119—as target loci. We then designed single-guided RNA sequences targeting the open reading frame of these genes, using the web-based sgRNA prediction program CRISPR4P13. Among the sgRNA target sequences suggested by CRISPR4P, we selected two sequences that are in the proximity of the initiation codon of each ORF, because an allele in which a point mutation is located close to either the 5’ or 3’ end of an ORF is suitable for single crossover chromosomal integration.

We introduced PCR fragments including sgRNA target sequences and part of ura4+ into an ura4-D18 mutant JY743 together with digested pDB4280 containing Cas9 and the 5’ part of ura4+12. After detecting Ura+ transformants, we checked the amino acid auxotrophy of the transformants. Similar to the situation observed for his1, many Ura+ transformants were obtained from both sgRNA #1 and #2 transformation. However, only a few strains showed amino acid auxotrophy, suggesting that these sgRNAs were not effective for targeting each site. The same was true for lys1 sgRNA #1 transformants. On the contrary, in the case of lys1 sgRNA #2 transformants, many transformants showed amino acid auxotrophy, despite the lower number of transformants compared with lys1 sgRNA #1. Many auxotrophic transformants were also obtained from two different sgRNAs in the case of arg3. We subsequently analyzed whether and where a mutation has occurred in the targeted gene by sequencing after PCR amplification of the ORF region. As a result, we found several mutations in lys1 and arg3, but not in his1 (Fig. 2a,b). There were also several arginine auxotrophic mutants that had no mutations in the ORF region of arg3, similar to the situation of his1. This may be due to off-target effects, as is often discussed with the CRISPR/Cas9 system. Most mutations found were single nucleotide deletions or insertions, all of which occurred only in the sequence used as an sgRNA target.

Mutations of auxotrophic mutants isolated in this study. All mutations of (a) lysine- and (b) arginine-auxotrophic mutants were found in the regions targeted by sgRNAs. Nucleotide sequences around the sgRNA target sequences are shown and amino acid sequences are shown beneath in the context of the reading frame. The number of the first nucleotide of each ORF is set to 1. The targeted sequences of sgRNA are underlined. An inserted nucleotide is shown in lowercase. A hyphen indicates a deleted nucleotide. An asterisk indicates a termination codon. Amino acid changes to the default sequence are indicated in italics. (c) The nucleotide and amino acid sequences of the arg3-R25 allele. The nucleotide sequence inserted is shown in bold. The expected amino acid sequence of the protein expressed from the arg3-R25 allele is shown below the nucleotide sequence.

Among these mutants, the arg3-R25 allele contains an insert of 262 nucleotides (Fig. 2c). Consistent with this result, a longer product was obtained by PCR amplification of this locus when the genome of the arg3-R25 strain was used as a template. A BLASTN search of this sequence revealed a complete match with a part of the genome of Oncorhynchus tshawytscha, known as chinook salmon or king salmon. This result strongly suggests that the 262-bp sequence came from the salmon sperm DNA used in the transformation of yeast cells, as previously reported20. Although the salmon sperm DNA we used originated from the salmon species Oncorhynchus keta, we could not find any sequence that matches the 262-bp sequence in the available O. keta dataset. Therefore, we have registered this sequence in the DDBJ database as part of the O. keta genome (accession no. LC764838). Because insertion of a long fragment was advantageous for chromosomal integration of a plasmid to avoid gene conversion-based complementation of a mutation21, we selected the arg3-R25 allele that serves as a target for the integration vector. In the case of lys1, we selected the lys1-K24 allele, having a deletion of adenine at the 268th nucleotide from the beginning of the lys1 ORF, resulting in the generation of a termination codon just downstream of this mutation site (Fig. 2a).

In parallel with mutant isolation, we designed and constructed vectors for chromosomal integration. For the construction of a vector named pCLys1 (Fig. 3a) that can be integrated into the lys1 locus, we amplified the genomic region containing the promoter and 5’ part of the lys1 ORF and replaced the leu1 region of the pDUAL vector with them. The cloned lys1 fragment was expected to be non-functional, because only less than 30% of the lys1 ORF was cloned. This short lys1 fragment was first amplified by PCR from the wild-type genome as two parts and then fused with a NotI recognition site between them. Thus, the cloned partial gene could be split into two in the ORF region by NotI digestion. The NotI site was created approximately 700 bp downstream of the mutation point of the lys1-K24 allele. If the pCLys1 vector linearized by NotI digestion is integrated into the lys1 locus having the lys1-K24 mutation, a functional lys1 gene would be generated, and the transformants are expected to be lysine prototrophic (Fig. 4a).

Vectors developed in this study. Structure of pCLys1 (a) and pCArg3 (b). The selection marker consists of the promoter and a part of the ORF of either lys1 (pCLys1) or arg3 (pCArg3). Both vectors have the nmt1 promoter and the ADH1 terminator for heterologous gene expression. Multicloning sites contain recognition sequences for NheI, XhoI, SmaI, BamHI, and AscI. An arrowhead indicates the NotI site for linearization of the plasmids. The schematic is not to scale.

A conceptual diagram that summarizes integration of vectors into the genome. Integration of pCLys1 (a) and pCArg3 (b) into the chromosome is shown. An asterisk indicates the mutation point of the lys1-K24 allele. A box with diagonal lines indicates a 262 bp fragment inserted within the ORF of arg3. The length of the vector backbone is not to scale.

We also constructed the pCArg3 vector for integration into the arg3 locus through a similar process (Fig. 3b). As was the case for lys1, the partial arg3 fragment cloned into the pCArg3 vector was expected to be non-functional, because the end of the cloned fragment was still upstream of the mutation points in the alleles obtained by arg3 sgRNA #1 transformation.

We subsequently examined whether the newly developed vectors could be integrated into the target loci as expected (Fig. 4a,b). If strains having the lys1-K24 or arg3-R25 alleles are transformed with pCLys1 or pCArg3, respectively, prototrophic transformants would be obtained. We linearized these plasmids with NotI prior to the transformation of the yeast cells. As a control, we introduced the plasmids directly into the auxotrophic mutants to examine whether linearization is required for integration or not.

After the introduction of plasmids or their digested fragments into auxotrophic mutants, large colonies appeared only from the strains transformed with digested fragments for both lys1-K24 and arg3-R25 (Fig. 5a). Although tiny colonies appeared from the strains transformed with undigested plasmids, they did not become enlarged. To see whether any given gene could be expressed using the vectors developed in this study, we cloned an ORF encoding green fluorescent protein (GFP) into pCLys1 and pCArg3 as a representative. We integrated these plasmids into the chromosome and picked up some transformants without amino acid auxotrophy. When we checked GFP fluorescence after streaking transformants on an EMM2 plate, we observed signals that dispersed throughout the cells with a slight accumulation in the nucleus, consistent with the localization of free GFP proteins in fission yeast (Fig. 5b)22. To confirm that digested fragments were successfully integrated into the target loci, we examined the genome structure of the prototrophic transformants by colony PCR. This analysis demonstrated that all of the fragments derived from pCLys1-GFP or pCArg3-GFP were integrated into each target locus as expected only when GFP fluorescence was detected (Fig. 5c).

Introduction of newly developed vectors for heterologous gene expression. (a) Transformants that emerged after introduction of linearized plasmids developed in this study. Strains AM595 (h– leu1-32 lys1-K24) and AM597 (h– leu1-32 arg3-R25) were transformed with either pCLys1 or pCArg3 with or without NotI pretreatment and plated onto SD selection medium lacking lysine and arginine. (b) Expression of GFP introduced using pCLys1 and pCArg3. Transformants that emerged after introduction of linearized pCLys1-GFP and pCArg3-GFP into the lys1-K24 or arg3-R25 strains were detected and GFP fluorescence was monitored under fluorescence microscopy. (c) Confirmation of chromosomal integration by PCR. Integration of pCLys1-GFP or pCArg3-GFP into the chromosome was analyzed by PCR using primers indicated by arrowheads. Transformants #1 and #2 were strains in which GFP fluorescence was observed, whereas transformant #3 had no fluorescence. Lambda DNA digested with EcoT14I was used as a size marker. (d) Simultaneous expression of three proteins in a cell. Cells transformed with pCLys1, pCArg3, and pDUAL expressing uvi15-CFP, gpi16-YFP, and gar2-mCherry, respectively, were observed under fluorescence microscopy. Scale bars indicate 10 μm.

Finally, we examined whether 3 genes could be simultaneously expressed using the vectors developed in this study in combination with the previously developed pDUAL vector. To detect their expression, we employed three fluorescent proteins, CFP, YFP, and mCherry. We identified several proteins showing clear subcellular localization from our localization data archive15. We selected the nucleolar protein Gar2, the ER protein Gpi16, and Uvi15, which localizes at cell tips and septa, and cloned their ORFs upstream of CFP (pCLys1), YFP (pDUAL), and mCherry (pCArg3), respectively. These fusion genes were expressed under the control of the nmt1 promoter. We integrated these plasmids sequentially into the chromosome of a strain with the arg3-R25, lys1-K24, and leu1-32 alleles, and picked up some transformants exhibiting no amino acid auxotrophy. We also attempted to transform cells with all three plasmid fragments. However, we were unable to obtain any transformants under these conditions. Additionally, even when two out of the three plasmids were used, the number of transformants obtained was nearly negligible. When we checked the fluorescence after cultivating transformants on an EMM2 plate to activate the nmt1 promoter, we observed clear signals from all fusion proteins (Fig. 5d). As expected, Uvi15 showed constant localization to cell tips or septa, whereas Gpi16 was visualized at ER-like membranous structures. A strong signal of the nucleolar protein Gar2 was observed in a specific compartment in the nucleus. Thus, we demonstrated that the introduction and expression of three different transgenes is possible using the newly developed integration vectors.

We developed two sets of fission yeast host-vector systems that could be used for heterologous expression of genes from either the lys1 or arg3 loci. Using these vectors, we demonstrated that developed vectors were properly integrated into the target loci, resulting in the generation of prototroph transformants. In addition, we demonstrated that GFP cloned into the vectors was expressed as expected after chromosomal integration. This type of integration leads to the generation of duplicated sequences on either side of the integrated fragment1, which may serve as homology regions for further recombination that leads to the deletion of the integrated fragment, as pointed out previously3. To overcome this problem, integration vectors that do not produce repetitive genomic regions by employing double crossover recombination were developed3. Such stable replacements are suitable for long-term studies, although this comes at the expense of relatively low transformation efficiency. On the other hand, single crossover integration vectors show high transformation efficiency similar to that obtained by conventional plasmid introduction, even allowing for a small risk of producing further recombination. From these properties, single crossover vectors may be suitable for qualitative and quantitative experiments requiring high transformation efficiency such as screening using plasmid libraries. Practically, transformants obtained from the vectors developed in this study as well as pDUAL can be maintained in a medium lacking corresponding amino acids, thereby easily exerting selective pressure on the transformants.

One major concern associated with the utilization of the CRISPR/Cas9 system is the possibility of off-target effects, which involve the introduction of unintended mutations into genomic locations other than the intended target. In our study, we encountered several auxotrophic strains that retained the marker genes for the target, possibly as a result of off-target effects. Moreover, we observed an unexpected incorporation of a fragment of salmon DNA into the arg3 ORF. The inadvertent integration of exogenous DNA into the genome of the host organism represents an additional potential issue when employing the CRISPR/Cas9 system. Previous studies have reported the insertion of salmon DNA fragments into the genome of fission yeast20, and similar occurrences have also been documented in other organisms23, 24. Hence, while CRISPR/Cas9 offers substantial potential for genome editing, it is imperative to diligently consider off-target effects and unintended insertions. Although the process of obtaining the arg3-R25 allele was unexpected, the insertion of exogenous DNA at the 5’ region of the arg3 ORF is of great advantage to this experimental system. This is because the insertion exerts selection pressure on the recombination region downstream of the inserted point, which is ideal for obtaining proper integrants that undergo arginine auxotrophy (Fig. 4b). Thus, we selected arg3-R25 as the most suitable allele for targeting arg3 using the pCArg3-series vectors.

In fission yeast research, leu1+ and ura4+ have been mainly used as selection markers1. The most commonly used leu1 allele of the host is leu1-32, having a missense mutation in the leu1 ORF4. On the other hand, the most common ura4 marker used in the host strain is the complete deletion ura4-D1818. Therefore, ura4-D18 cannot be used for single crossover recombination. Although vectors employing other selection marker genes have been gradually developed, we still have limited options for chromosomal integration of a transgene. The vectors developed in this study will serve as a valuable option for heterologous gene expression from the chromosome in combination with most of the previously reported markers. In this context, these vectors will contribute considerably to experiments requiring the expression of multiple transgenes.

All data generated or analyzed during this study are included in this published article and its Supplementary Information files.

Polymerase chain reaction

Open reading frame

Single-guided RNA

Green fluorescent protein

Cyan fluorescent protein

Yellow fluorescent protein

Siam, R., Dolan, W. P. & Forsburg, S. L. Choosing and using Schizosaccharomyces pombe plasmids. Methods 33, 189–198 (2004).

Article CAS PubMed Google Scholar

Ergün, B. G., Hüccetoğulları, D., Öztürk, S., Çelik, E. & Çalık, P. Established and upcoming yeast expression systems. Methods Mol. Biol. 1923, 1–74 (2019).

Article Google Scholar

Vještica, A. et al. A toolbox of stable integration vectors in the fission yeast. J. Cell Sci. 133, jcs240754. https://doi.org/10.1242/jcs.240754 (2020).

Article CAS PubMed Google Scholar

Matsuyama, A. et al. pDUAL, a multipurpose, multicopy vector capable of chromosomal integration in fission yeast. Yeast 21, 1289–1305 (2004).

Article CAS PubMed Google Scholar

Matsuyama, A., Shirai, A. & Yoshida, M. A novel series of vectors for chromosomal integration in fission yeast. Biochem. Biophys. Res. Commun. 374, 315–319 (2008).

Article CAS PubMed Google Scholar

Jacobs, J. Z., Ciccaglione, K. M., Tournier, V. & Zaratiegui, M. Implementation of the CRISPR-Cas9 system in fission yeast. Nat. Commun. 5, 5344 (2014).

Article ADS CAS PubMed Google Scholar

Bhattacherjee, V. & Bhattacharjee, J. K. Nucleotide sequence of the Schizosaccharomyces pombe lys1+ gene and similarities of the lys1+ protein to peptide antibiotic synthetases. Yeast 14, 479–484 (1998).

3.0.CO;2-T" data-track-action="article reference" href="https://doi.org/10.1002%2F%28SICI%291097-0061%2819980330%2914%3A5%3C479%3A%3AAID-YEA236%3E3.0.CO%3B2-T" aria-label="Article reference 7" data-doi="10.1002/(SICI)1097-0061(19980330)14:53.0.CO;2-T">Article CAS PubMed Google Scholar

Van Huffel, C., Dubois, E. & Messenguy, F. Cloning and sequencing of arg3 and arg11 genes of Schizosaccharomyces pombe on a 10-kb. DNA fragment Heterologous expression and mitochondrial targeting of their translation products. Eur. J. Biochem. 205, 33–43 (1992).

Article PubMed Google Scholar

Gutz, H., Heslot, H., Leupold, U. & Loprieno, N. Schizosaccharomyces pombe. In Handbook of Genetics (ed. King, R. C.) 395–446 (Plenum Press, 1974).

Google Scholar

Maundrell, K. nmt1 of fission yeast. A highly transcribed gene completely repressed by thiamine. J. Biol. Chem. 265, 10857–10864 (1990).

Article CAS PubMed Google Scholar

Matsuyama, A., Yabana, N., Watanabe, Y. & Yamamoto, M. Schizosaccharomyces pombe Ste7p is required for both promotion and withholding of the entry to meiosis. Genetics 155, 539–549 (2000).

Article CAS PubMed PubMed Central Google Scholar

Zhang, X. R., He, J. B., Wang, Y. Z. & Du, L. L. A cloning-free method for CRISPR/Cas9-mediated genome editing in fission yeast. G3 8, 2067–2077 (2018).

Article CAS PubMed PubMed Central Google Scholar

Rodríguez-López, M. et al. A CRISPR/Cas9-based method and primer design tool for seamless genome editing in fission yeast. Wellcome Open Res. 1, 19. https://doi.org/10.12688/wellcomeopenres.10038.3 (2016).

Article CAS PubMed Google Scholar

Jacobus, A. P. & Gross, J. Optimal cloning of PCR fragments by homologous recombination in Escherichia coli. PLoS ONE 10, e0119221. https://doi.org/10.1371/journal.pone.0119221 (2015).

Article CAS PubMed PubMed Central Google Scholar

Matsuyama, A. et al. ORFeome cloning and global analysis of protein localization in the fission yeast Schizosaccharomyces pombe. Nat. Biotechnol. 24, 841–847 (2006).

Article CAS PubMed Google Scholar

Kikuchi, Y., Kitazawa, Y., Shimatake, H. & Yamamoto, M. The primary structure of the leu1+ gene of Schizosaccharomyces pombe. Curr. Genet. 14, 375–379 (1988).

Article CAS PubMed Google Scholar

Szankasi, P., Heyer, W. D., Schuchert, P. & Kohli, J. DNA sequence analysis of the ade6 gene of Schizosaccharomyces pombe: Wild-type and mutant alleles including the recombination host spot allele ade6-M26. J. Mol. Biol. 204, 917–925 (1988).

Article CAS PubMed Google Scholar

Grimm, C., Kohli, J., Murray, J. & Maundrell, K. Genetic engineering of Schizosaccharomyces pombe: A system for gene disruption and replacement using the ura4 gene as a selectable marker. Mol. Gen. Genet. 215, 81–86 (1988).

Article CAS PubMed Google Scholar

Erickson, F. L. & Hannig, E. M. Characterization of Schizosaccharomyces pombe his1 and his5 cDNAs. Yeast 11, 157–167 (1995).

Article CAS PubMed Google Scholar

Longmuir, S., Akhtar, N. & MacNeill, S. A. Unexpected insertion of carrier DNA sequences into the fission yeast genome during CRISPR-Cas9 mediated gene deletion. BMC Res. Notes 12, 191 (2019).

Article PubMed PubMed Central Google Scholar

Keeney, J. B. & Boeke, J. D. Efficient targeted integration at leu1-32 and ura4-294 in Schizosaccharomyces pombe. Genetics 136, 849–856 (1994).

Article CAS PubMed PubMed Central Google Scholar

Atkins, D. & Izant, J. G. Expression and analysis of the green fluorescent protein gene in the fission yeast Schizosaccharomyces pombe. Curr. Genet. 28, 585–588 (1995).

Article CAS PubMed Google Scholar

Hunt, J. M. T., Samson, C. A., Rand, A. D. & Sheppard, H. M. Unintended CRISPR-Cas9 editing outcomes: A review of the detection and prevalence of structural variants generated by gene-editing in human cells. Hum. Genet. 142, 705–720 (2023).

Article PubMed PubMed Central Google Scholar

Banakar, R. et al. High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice. Sci. Rep. 9, 19902 (2019).

Article ADS CAS PubMed PubMed Central Google Scholar

Download references

This work was supported partly by JSPS KAKENHI Grant Numbers 15K14925 and 22K05361.

Chemical Genomics Research Group, RIKEN Center for Sustainable Resource Science, 2-1, Hirosawa, Wako, Saitama, 351-0198, Japan

Akihisa Matsuyama, Atsushi Hashimoto & Minoru Yoshida

Laboratory of Microbiology, Department of Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Tokyo, 113-8657, Japan

Akihisa Matsuyama, Shinichi Nishimura & Minoru Yoshida

Collaborative Research Institute for Innovative Microbiology, The University of Tokyo, Tokyo, 113-8657, Japan

Shinichi Nishimura & Minoru Yoshida

Graduate School of Integrated Sciences for Life, Hiroshima University, Higashi-Hiroshima, 739-8528, Japan

Shinichi Nishimura

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

You can also search for this author in PubMed Google Scholar

This work was conceptualized by A.M. and M.Y. All experiments were done by A.M. and A.H. A.M. prepared the original draft. S.N. and M.Y. edited the manuscript. All authors reviewed the manuscript.

Correspondence to Akihisa Matsuyama.

The authors declare no competing interests.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

Matsuyama, A., Hashimoto, A., Nishimura, S. et al. A set of vectors and strains for chromosomal integration in fission yeast. Sci Rep 13, 9295 (2023). https://doi.org/10.1038/s41598-023-36267-1

Download citation

Received: 03 February 2023

Accepted: 31 May 2023

Published: 08 June 2023

DOI: https://doi.org/10.1038/s41598-023-36267-1

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.